Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 3965093
End position: 3965119
Length: 27

DNA sequence
>NC_013446, from 3965093 to 3965119 (27 bp); Comamonas testosteroni CNB-2 GATGATGCCGATGATGGCGATGATGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3964680-3967880	Sequence	CtCNB1_3507 - acriflavin resistance protein (Protein is coded in complementary strand; from 3967880 to 3964680)