Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 3888638
End position: 3888661
Length: 24

DNA sequence
>NC_013446, from 3888638 to 3888661 (24 bp); Comamonas testosteroni CNB-2 GCGGCAGCGGCTGCTGCAGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3887840-3888784	Sequence	CtCNB1_3437 - electron transfer flavoprotein subunit alpha (Protein is coded in complementary strand; from 3888784 to 3887840)