Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 3857817
End position: 3857840
Length: 24

DNA sequence
>NC_013446, from 3857817 to 3857840 (24 bp); Comamonas testosteroni CNB-2 GAAGCGGCGCAGCGGCGATGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3857503-3859422	Sequence	CtCNB1_3410 - m-hydroxybenzoate hydroxylase (Protein is coded in complementary strand; from 3859422 to 3857503)