Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 3295953
End position: 3295997
Length: 45

DNA sequence
>NC_013446, from 3295953 to 3295997 (45 bp); Comamonas testosteroni CNB-2 CGGCGGCCGTCTTGGCGGCGGGCTTCTTGGCCGCAGCCTTCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3295805-3296482	Sequence	CtCNB1_2896 - iojap-like protein (Protein is coded in complementary strand; from 3296482 to 3295805)