Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2717893
End position: 2717916
Length: 24

DNA sequence
>NC_013446, from 2717893 to 2717916 (24 bp); Comamonas testosteroni CNB-2 CAGGCCCAGACCCAGGCCCAGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2717774-2719648	Sequence	CtCNB1_2380 - periplasmic sensor signal transduction (Protein is coded in complementary strand; from 2719648 to 2717774)