Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2488604
End position: 2488627
Length: 24

DNA sequence
>NC_013446, from 2488604 to 2488627 (24 bp); Comamonas testosteroni CNB-2 GAGGCCGAGGCCCAGGCCGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2487830-2490031	Sequence	CtCNB1_2183 - catalase/peroxidase HPI (Protein is coded in complementary strand; from 2490031 to 2487830)