Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2449884
End position: 2449910
Length: 27

DNA sequence
>NC_013446, from 2449884 to 2449910 (27 bp); Comamonas testosteroni CNB-2 TCGTCGTGATCGTGGTGATCGTCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2449512-2449937	Sequence	CtCNB1_2148 - cytochrome C oxidase subunit IV (Protein is coded in complementary strand; from 2449937 to 2449512)