Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2405284
End position: 2405307
Length: 24

DNA sequence
>NC_013446, from 2405284 to 2405307 (24 bp); Comamonas testosteroni CNB-2 GCCGCCGCCGGCGTCGCCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2405183-2406484	Sequence	CtCNB1_2117 - RND family efflux transporter MFP subunit