Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2333377
End position: 2333400
Length: 24

DNA sequence
>NC_013446, from 2333377 to 2333400 (24 bp); Comamonas testosteroni CNB-2 ATCGGGATCGCGCTCGGGATCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2332607-2333830	Sequence	CtCNB1_2056 - acetyl-CoA acetyltransferase (Protein is coded in complementary strand; from 2333830 to 2332607)