Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2127572
End position: 2127595
Length: 24

DNA sequence
>NC_013446, from 2127572 to 2127595 (24 bp); Comamonas testosteroni CNB-2 TGGTCATGGTCTTCGTCATGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2127284-2128330	Sequence	CtCNB1_1882 - cobalamin biosynthesis protein CobW (Protein is coded in complementary strand; from 2128330 to 2127284)