Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2122491
End position: 2122520
Length: 30

DNA sequence
>NC_013446, from 2122491 to 2122520 (30 bp); Comamonas testosteroni CNB-2 AGCTGGCTGGAGCTGCCCGGATCTGGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2122173-2123321	Sequence	CtCNB1_1880 - ATPase (Protein is coded in complementary strand; from 2123321 to 2122173)