Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2018110
End position: 2018133
Length: 24

DNA sequence
>NC_013446, from 2018110 to 2018133 (24 bp); Comamonas testosteroni CNB-2 CCTGTGCCAGTGCCTGGGCCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2018097-2019317	Sequence	CtCNB1_1780 - bile acid-inducible L-carnitine dehydratase (Protein is coded in complementary strand; from 2019317 to 2018097)