Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2016241
End position: 2016288
Length: 48

DNA sequence
>NC_013446, from 2016241 to 2016288 (48 bp); Comamonas testosteroni CNB-2 AAAAAGCCGGCAACAAAGCCGGTAACAAAGGCGGCAACAAAGGCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2013833-2016352	Sequence	CtCNB1_1777 - Orn/Lys/Arg decarboxylase, major region