Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1807034
End position: 1807057
Length: 24

DNA sequence
>NC_013446, from 1807034 to 1807057 (24 bp); Comamonas testosteroni CNB-2 GATCTTGGTCTTGAGCTTGAACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1806426-1807229	Sequence	CtCNB1_1593 - carbon monoxide dehydrogenase subunit G (Protein is coded in complementary strand; from 1807229 to 1806426)