Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1280110
End position: 1280133
Length: 24

DNA sequence
>NC_013446, from 1280110 to 1280133 (24 bp); Comamonas testosteroni CNB-2 GCAGCACCAGCAGCACCAGAAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1279440-1280315	Sequence	CtCNB1_1146 - inner-membrane translocator (Protein is coded in complementary strand; from 1280315 to 1279440)