Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1246600
End position: 1246623
Length: 24

DNA sequence
>NC_013446, from 1246600 to 1246623 (24 bp); Comamonas testosteroni CNB-2 GGTGCTGGAGTGCTGGGGCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1245754-1247280	Sequence	CtCNB1_1110 - cell wall hydrolase/autolysin (Protein is coded in complementary strand; from 1247280 to 1245754)