Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1226179
End position: 1226203
Length: 25

DNA sequence
>NC_013446, from 1226179 to 1226203 (25 bp); Comamonas testosteroni CNB-2 CAGTGCGGTGCCGTGAAGTGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1225450-1226772	Sequence	CtCNB1_1093 - sulfatase (Protein is coded in complementary strand; from 1226772 to 1225450)