Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 116117
End position: 116140
Length: 24

DNA sequence
>NC_013446, from 116117 to 116140 (24 bp); Comamonas testosteroni CNB-2 TGGGCATGGTCATGGGCATGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 115526-116221	Sequence	CtCNB1_0103 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 116221 to 115526)