Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1141621
End position: 1141647
Length: 27

DNA sequence
>NC_013446, from 1141621 to 1141647 (27 bp); Comamonas testosteroni CNB-2 CGGCCGCCGCGACCGCCGCGGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1140832-1141962	Sequence	CtCNB1_1010 - molecular chaperone DnaJ (Protein is coded in complementary strand; from 1141962 to 1140832)