Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 1039316
End position: 1039339
Length: 24

DNA sequence
>NC_013446, from 1039316 to 1039339 (24 bp); Comamonas testosteroni CNB-2 GCAGCAGCAGCGGCGGCAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1038994-1040010	Sequence	CtCNB1_0927 - histidine kinase internal region (Protein is coded in complementary strand; from 1040010 to 1038994)