Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 395538
End position: 395573
Length: 36

DNA sequence
>NC_013446, from 395538 to 395573 (36 bp); Comamonas testosteroni CNB-2 TTTCTGGCCGTGTTTGGGGCCGTGGTGCTGGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 394567-396888	Sequence	CtCNB1_0362 - multi-sensor signal transduction histidine kinase