Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2104053
End position: 2104088
Length: 36

DNA sequence
>NC_013446, from 2104053 to 2104088 (36 bp); Comamonas testosteroni CNB-2 GCCACCAGTGCCACCAGTGCCACCAGTGCCACCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2102758-2104302	Sequence	CtCNB1_1859 - hypothetical protein (Protein is coded in complementary strand; from 2104302 to 2102758)