Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 2016243
End position: 2016278
Length: 36

DNA sequence
>NC_013446, from 2016243 to 2016278 (36 bp); Comamonas testosteroni CNB-2 AAAGCCGGCAACAAAGCCGGTAACAAAGGCGGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2013833-2016352	Sequence	CtCNB1_1777 - Orn/Lys/Arg decarboxylase, major region