Sequence retrieval

Genome: Comamonas testosteroni CNB-2
Start position: 725901
End position: 725927
Length: 27

DNA sequence
>NC_013446, from 725901 to 725927 (27 bp); Comamonas testosteroni CNB-2 GCCCATGCCGCCCATGCCGCCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 725896-727539	Sequence	CtCNB1_0643 - molecular chaperone GroEL (Protein is coded in complementary strand; from 727539 to 725896)