Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 948692
End position: 948727
Length: 36

DNA sequence
>NC_013441, from 948692 to 948727 (36 bp); Gordonia bronchialis DSM 43247 GGTCTCGTCGCCGGTCTGGTCGCCGGTCTGGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 948651-950348	Sequence	Gbro_0890 - major facilitator superfamily protein (Protein is coded in complementary strand; from 950348 to 948651)