Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 901603
End position: 901626
Length: 24

DNA sequence
>NC_013441, from 901603 to 901626 (24 bp); Gordonia bronchialis DSM 43247 CGACGAGGACGACGGCGACGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 901503-902984	Sequence	Gbro_0842 - EmrB/QacA subfamily drug resistance transporter (Protein is coded in complementary strand; from 902984 to 901503)