Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 893022
End position: 893046
Length: 25

DNA sequence
>NC_013441, from 893022 to 893046 (25 bp); Gordonia bronchialis DSM 43247 CCGCGGCGCGCCGAGCAGCGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 892714-893658	Sequence	Gbro_0832 - esterase (Protein is coded in complementary strand; from 893658 to 892714)