Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4853902
End position: 4853925
Length: 24

DNA sequence
>NC_013441, from 4853902 to 4853925 (24 bp); Gordonia bronchialis DSM 43247 TCGCCGTTGCCGTGGCCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4853833-4855008	Sequence	Gbro_4527 - signal transduction histidine kinase-like protein