Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 485089
End position: 485139
Length: 51

DNA sequence
>NC_013441, from 485089 to 485139 (51 bp); Gordonia bronchialis DSM 43247 TCTGGCGCTGACGTTGATCTGGCGCTGACGTTGATCTGGCGCTGACGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 484456-485100	Sequence	Gbro_0434 - bifunctional deaminase-reductase-like protein