Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4845981
End position: 4846022
Length: 42

DNA sequence
>NC_013441, from 4845981 to 4846022 (42 bp); Gordonia bronchialis DSM 43247 GTCGTCAGTCTGCGTTCGTCAGTCTGCGTTCGTCACTCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4846014-4846700	Sequence	Gbro_4520 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 4846700 to 4846014)