Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4803706
End position: 4803750
Length: 45

DNA sequence
>NC_013441, from 4803706 to 4803750 (45 bp); Gordonia bronchialis DSM 43247 TCGTCGCACCAGGGGTCGTCCCAGCCGGGGTCGTCCCAGCCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4800767-4804054	Sequence	Gbro_4481 - RND superfamily drug exporter-like protein