Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4732686
End position: 4732739
Length: 54

DNA sequence
>NC_013441, from 4732686 to 4732739 (54 bp); Gordonia bronchialis DSM 43247 CTGGCCCGGCTGATACGGCTGGCCCTGCTGGTAAGGCTGGCCCGCCTGGTACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4732093-4732803	Sequence	Gbro_4422 - hypothetical protein (Protein is coded in complementary strand; from 4732803 to 4732093)