Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4716604
End position: 4716627
Length: 24

DNA sequence
>NC_013441, from 4716604 to 4716627 (24 bp); Gordonia bronchialis DSM 43247 CACCGCGACCGCGACCGCCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4716581-4716904	Sequence	Gbro_4409 - hypothetical protein (Protein is coded in complementary strand; from 4716904 to 4716581)