Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4715115
End position: 4715141
Length: 27

DNA sequence
>NC_013441, from 4715115 to 4715141 (27 bp); Gordonia bronchialis DSM 43247 AGTCGTCGAGGTCGTCGAAGTTGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4715114-4715389	Sequence	Gbro_4407 - hypothetical protein (Protein is coded in complementary strand; from 4715389 to 4715114)