Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 458337
End position: 458360
Length: 24

DNA sequence
>NC_013441, from 458337 to 458360 (24 bp); Gordonia bronchialis DSM 43247 TCGACGTCGGCGTCGTCGTAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 457728-458507	Sequence	Gbro_0409 - TipAS antibiotic-recognition domain-containing protein (Protein is coded in complementary strand; from 458507 to 457728)