Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4572862
End position: 4572885
Length: 24

DNA sequence
>NC_013441, from 4572862 to 4572885 (24 bp); Gordonia bronchialis DSM 43247 GTCGGCTTCGGCGCCGGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4572848-4573492	Sequence	Gbro_4269 - GrpE protein HSP-70 cofactor (Protein is coded in complementary strand; from 4573492 to 4572848)