Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4459586
End position: 4459630
Length: 45

DNA sequence
>NC_013441, from 4459586 to 4459630 (45 bp); Gordonia bronchialis DSM 43247 TGTCGCCGAATCTGTTGTCCCCGAATCTGTTGTCCCCGAATCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4458424-4461312	Sequence	Gbro_4160 - oxidoreductase FAD/NAD(P)-binding domain-containing protein