Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4438311
End position: 4438366
Length: 56

DNA sequence
>NC_013441, from 4438311 to 4438366 (56 bp); Gordonia bronchialis DSM 43247 TCTGCGTCTATCCATCTGGGTCTATCCATCTGGGTCTATCCATCTGGGTCTATCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4438361-4438996	Sequence	Gbro_4138 - isochorismatase hydrolase (Protein is coded in complementary strand; from 4438996 to 4438361)