Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4361300
End position: 4361323
Length: 24

DNA sequence
>NC_013441, from 4361300 to 4361323 (24 bp); Gordonia bronchialis DSM 43247 GCGGCCGCGACCGTGGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4360970-4361410	Sequence	Gbro_4061 - hypothetical protein (Protein is coded in complementary strand; from 4361410 to 4360970)