Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4343434
End position: 4343460
Length: 27

DNA sequence
>NC_013441, from 4343434 to 4343460 (27 bp); Gordonia bronchialis DSM 43247 GGGCCACCGGGGCCACCGGGGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4343278-4345092	Sequence	Gbro_4045 - phosphoribosylglycinamide formyltransferase 2 (Protein is coded in complementary strand; from 4345092 to 4343278)