Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4314184
End position: 4314228
Length: 45

DNA sequence
>NC_013441, from 4314184 to 4314228 (45 bp); Gordonia bronchialis DSM 43247 TACTGGGGGTTCGGGTACTGGGGGTTCGGATACTGGGGATTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4313935-4316316	Sequence	Gbro_4017 - ATP-dependent metalloprotease FtsH (Protein is coded in complementary strand; from 4316316 to 4313935)