Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4239538
End position: 4239597
Length: 60

DNA sequence
>NC_013441, from 4239538 to 4239597 (60 bp); Gordonia bronchialis DSM 43247 TCAGCGGTCGGGTTCTCAGCGGTCGGGTTCTCAGCGGTCGGGTTCTCAGCGGTCGGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4238599-4239633	Sequence	Gbro_3944 - hypothetical protein (Protein is coded in complementary strand; from 4239633 to 4238599)