Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4172540
End position: 4172563
Length: 24

DNA sequence
>NC_013441, from 4172540 to 4172563 (24 bp); Gordonia bronchialis DSM 43247 GCCGGTGCCGTTGACGGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4172181-4173143	Sequence	Gbro_3880 - hypothetical protein (Protein is coded in complementary strand; from 4173143 to 4172181)