Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 4045771
End position: 4045824
Length: 54

DNA sequence
>NC_013441, from 4045771 to 4045824 (54 bp); Gordonia bronchialis DSM 43247 GCTGCTGACCGAACTGTCCCGGCTGACCGTACTGTCTCGGCTGACCGAACTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4044966-4045967	Sequence	Gbro_3763 - hypothetical protein (Protein is coded in complementary strand; from 4045967 to 4044966)