Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3868960
End position: 3869019
Length: 60

DNA sequence
>NC_013441, from 3868960 to 3869019 (60 bp); Gordonia bronchialis DSM 43247 GCCGGACCAGATGGGGCCGGACCAGATGGGGCCGGACCAGACGGGGCCGGACCAGACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3868279-3869091	Sequence	Gbro_3638 - hypothetical protein (Protein is coded in complementary strand; from 3869091 to 3868279)