Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3822607
End position: 3822669
Length: 63

DNA sequence
>NC_013441, from 3822607 to 3822669 (63 bp); Gordonia bronchialis DSM 43247 CAGCACCGCGTTTCACGCCGACAGCACCGCGATTCTCGCCGACAGCACCGCGATTCTCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3822620-3822799	Sequence	Gbro_3597 - hypothetical protein (Protein is coded in complementary strand; from 3822799 to 3822620)