Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3761534
End position: 3761578
Length: 45

DNA sequence
>NC_013441, from 3761534 to 3761578 (45 bp); Gordonia bronchialis DSM 43247 CCCGGCTGCTTCAGACCCTGCTGTGTCAGACCCTGTTGCGTCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3761575-3761850	Sequence	Gbro_3537 - transglycosylase (Protein is coded in complementary strand; from 3761850 to 3761575)