Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3696165
End position: 3696188
Length: 24

DNA sequence
>NC_013441, from 3696165 to 3696188 (24 bp); Gordonia bronchialis DSM 43247 GGCGCGGGCGCTGCCGCGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3694598-3696220	Sequence	Gbro_3480 - fumarate reductase/succinate dehydrogenase flavoprotein domain-containing protein