Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3441562
End position: 3441606
Length: 45

DNA sequence
>NC_013441, from 3441562 to 3441606 (45 bp); Gordonia bronchialis DSM 43247 GTGGCCTTCTTCGCCGCAGCCTTCTTGGCCGCGGTCTTCTTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3441475-3442056	Sequence	Gbro_3213 - histone family protein DNA-binding protein (Protein is coded in complementary strand; from 3442056 to 3441475)