Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3399111
End position: 3399134
Length: 24

DNA sequence
>NC_013441, from 3399111 to 3399134 (24 bp); Gordonia bronchialis DSM 43247 CGCCAGCGCCCGCGCCAGCGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3398554-3399555	Sequence	Gbro_3171 - sulfate ABC transporter ATPase (Protein is coded in complementary strand; from 3399555 to 3398554)